![]() ![]() Reads that start or end with very low quality can be aligned better if the bad quality parts are trimmed off. However, if there is a short partial adapter present at the end of the forward read and the beginning of the reverse read, that is a good sign for a “palindrome” sequence. While a full adapter sequence can be identified relatively easily, reliably identifying a short partial adapter sequence is inherently difficult. In the latter case the forward and the reverse read will contain adapter sequences, which is called a “palindrome”. Sometimes Illumina adapter sequences are still present in some reads because adapters can form adapter dimers and then one of them gets sequenced or if a DNA fragment is shorter than the read length, the sequencer continues to “read-through” into the adapter at the end of the DNA fragment. Trimming reads and removing adapter sequences - Comparative genomics with Orthofinder.- Demographic modeling with fastsimcoal2.- Estimating the site-frequency-spectrum.- Identifying selection with haplotype statistics.- Sliding window differentiation, variance and introgression.- Data manipulation and visualisation in R.- Checking for PCR duplication problems, contamination, etc.NEB 3' adaptor (3' SR Adaptor 1) 5' ATCGTATGCCGTCTTCTGCTTG 3'ģ' AGCATACGGCAGAAGACGAAC 5' (reverse of NEB SR Primer F1)ģ' CTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGCCGATGTAGAGCATACGGCAGAAGACGAAC 5' (rev. RNA PCR Primer, Index 1 (RPI1) code ATCACG in DNA, RC (CGTGAT)ĥ' CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA 3' - RNA pcr primerĬAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (RC of DNA Index 1 for comparison)ģ' RNA adaptor 3' CCTTGGCACCCGAGAATTCCA - 5'ĭifferences with NEB Small RNA kit (RP1/SR Primer R1/SR Adaptor 1/5' RNA adaptor are all the same):ĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG (TruSeq Adaptor Ind 12) Oligonucleotide sequences for TruSeq Small RNA Sample Prep KitsĮxample (all Illumina sequences unless noted):ĥ’ AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGAĪATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGTCCGA - this is the NEB SR Primer R1 - pads added by SPHSĥ' RNA adaptor GUUCAGAGUUCUACAGUCCGACGAUC (NEB kit calls this the SR Adaptor 1) So order RC of TruSeq Adaptor Indexes as PCR primers TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG Mux read 2 seq primer (reversed)ĬTTGAGGTCAGTGGAACATTAGAGCATACGGCAGAAGACGAAC Index 12 PCR primer (reversed) Oligonucleotide sequences for TruSeqTM RNA and DNA Sample Prep Kits1ĥ’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGĥ' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC Mux index read seq primer Some additional 5 bp barcodes can be found here: Īfter exhaustive searching of all 4096 6-mers, the following table is all remaining 6 bp barcodes that have hamming distance of at least 3 from each other and the table above of 49 barcodes (NOTE: these have NOT been tested on the sequencer as of 2/7/12): NOTE that TSBC41 is hamming distance 2 away from both TSBC31 and TSBC11 all others are hamming distance >=3. ![]() In other words, here is the first barcode shown in the context of the full 3'-end adaptor construct: GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG Note that these sequences are shown 5'-3' when the P5 sequence is on the left. The GSAF uses the following names for the following barcodes. If you are using dual-indexed samples with an additional barcode between the P5 bridge PCR primer site and the Read 1 sequencing primer site, we can easily accommodate that on a run but do not normally do so - you need to tell us. The GSAF expects indexes to be in the 3' end of the final sequencing construct, between the Index read sequencing primer site and the P7 PCR primer site. NOTE: Illumina barcodes (indexes) have varied significantly over time NOT ONLY in their sequence but also in WHERE they are placed in the sequencing construct. I7 bases for entry on sample sheet (HiSeq, MiSeq, or NextSeq)
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |